Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of JTB-jumping translocation breakpoint Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about JTB-jumping translocation breakpoint Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000499 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | JTB |
| Origin species: | Human |
| Product name: | JTB-jumping translocation breakpoint Gene |
| Size: | 2ug |
| Accessions: | BC000499 |
| Gene id: | 10899 |
| Gene description: | jumping translocation breakpoint |
| Synonyms: | protein JTB; HJTB; HSPC222; PAR; hJT; jumping translocation breakpoint protein; prostate androgen-regulated protein; jumping translocation breakpoint |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttgcgggtgccgggaggcctggcctcccccagggccgccacctctgctggttgctctgtgctttcaccttaaagctctgccaagcagaggctcccgtgcaggaagagaagctgtcagcaagcacctcaaatttgccatgctggctggtggaagagtttgtggtagcagaagagtgctctccatgctctaatttccgggctaaaactacccctgagtgtggtcccacaggatatgtagagaaaatcacatgcagctcatctaagagaaatgagttcaaaagctgccgctcagctttgatggaacaacgcttattttggaagttcgaaggggctgtcgtgtgtgtggccctgatcttcgcttgtcttgtcatcattcgtcagcgacaattggacagaaaggctctggaaaaggtccggaagcaaatcgagtccatatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycophorin A (MNS blood group) - glycophorin A (MNS blood group) - natriuretic peptide precursor A - hypothetical protein MGC12972 |