> >>SCP2-sterol carrier protein 2 Gene
SCP2-sterol carrier protein 2 Gene View larger

SCP2-sterol carrier protein 2 Gene

PTXBC005911

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SCP2-sterol carrier protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCP2-sterol carrier protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005911
Product type: DNA & cDNA
Ncbi symbol: SCP2
Origin species: Human
Product name: SCP2-sterol carrier protein 2 Gene
Size: 2ug
Accessions: BC005911
Gene id: 6342
Gene description: sterol carrier protein 2
Synonyms: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX; non-specific lipid-transfer protein; propanoyl-CoA C-acyltransferase; sterol carrier protein X
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttttccggaagccgccagttcttttagaactcatcaaattgaagctgttccaaccagctctgcaagtgatggatttaaggcaaatcttgtttttaaggagattgagaagaaacttgaagaggaaggggaacagtttgtgaagaaaatcggtggtatttttgccttcaaggtgaaagatggccctgggggtaaagaggccacctgggtggtggatgtgaagaatggcaaaggatcagtgcttcctaactcagataagaaggctgactgcacaatcacaatggctgactcagacttcctggctttaatgactggtaaaatgaatcctcagtcggccttctttcaaggcaaattgaaaatcactggcaacatgggtctcgctatgaagttacaaaatcttcagcttcagccaggcaacgctaagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prolactin-induced protein
- ribosomal protein L27a
- gastrin-releasing peptide
- pallidin homolog (mouse)

Reviews

Buy SCP2-sterol carrier protein 2 Gene now

Add to cart