Cart 15 Product Products 1 707,89 € (empty)
-
-
1 x EDNRB-endo...121,50 € -
-
1 x FAM43A-fam...121,50 € -
-
1 x CMTM2-CKLF...113,40 € -
1 x C8orf34-ch...121,50 € -
1 x C20orf112-...121,50 € -
1 x E2F2-E2F...113,40 € -
-
-
-
1 x SUMF1-sulf...121,50 € -
1 x COL8A2-col...121,50 € -
1 x ELOF1-elon...113,40 €
No products
To be determined Shipping
1 707,89 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 707,89 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 707,89 €
Data sheet of MRPL42-mitochondrial ribosomal protein L42 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL42-mitochondrial ribosomal protein L42 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040240 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL42 |
| Origin species: | Human |
| Product name: | MRPL42-mitochondrial ribosomal protein L42 Gene |
| Size: | 2ug |
| Accessions: | BC040240 |
| Gene id: | 28977 |
| Gene description: | mitochondrial ribosomal protein L42 |
| Synonyms: | HSPC204; L31MT; L42MT; MRP-L31; MRP-L42; MRP-S32; MRPL31; MRPS32; PTD007; RPML31; S32MT; 39S ribosomal protein L42, mitochondrial; 28S ribosomal protein S32, mitochondrial; 39S ribosomal protein L31, mitochondrial; mitochondrial ribosomal protein L42 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgtagctgcagtaaaatgggtgatgtcaaagagaactatcttgaaacatttatttccagtccaaaatggagctttatattgtgtttgtcataaatctacgtattctcctctaccagatgactataattgcaacgtagagcttgctctgacttctgatggcaggacaatagtatgctaccacccttctgtggacattccatatgaacacacaaaacctatccctcggccagatcctgtgcataataatgaagaaacacatgatcaagtgctgaaaaccagattggaagaaaaagttgaacaccttgaggaaggacctatgatagaacaacttagcaaaatgttctttactactaagcaccgttggtatcctcatggacggtatcacagatgtcgtaagaatctgaatcctccaaaagacagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 62 - SCAN domain containing 2 pseudogene - chromosome 3 open reading frame 34 - destrin (actin depolymerizing factor) |