Cart 17 Product Products 2 392,74 € (empty)
-
1 x RAB6A-RAB6...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x IDI1-isope...113,40 € -
-
1 x AASDHPPT-a...121,50 € -
1 x OCM-oncomo...113,40 € -
1 x IFNA21-int...113,40 € -
1 x IFNB1-inte...113,40 € -
1 x ABHD14A...259,07 € -
-
1 x DDIT4L-DNA...113,40 € -
1 x APLN-apeli...113,40 € -
1 x UBE2V1-ubi...113,40 € -
-
1 x ST3GAL3-ST...121,50 € -
-
1 x RAC2-ras-r...113,40 €
No products
To be determined Shipping
2 392,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 392,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 392,74 €
View larger 
ATG4D-ATG4 autophagy related 4 homolog D (S. cerevisiae) Gene
PTXBC007639
New product
Data sheet of ATG4D-ATG4 autophagy related 4 homolog D (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATG4D-ATG4 autophagy related 4 homolog D (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007639 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATG4D |
| Origin species: | Human |
| Product name: | ATG4D-ATG4 autophagy related 4 homolog D (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC007639 |
| Gene id: | 84971 |
| Gene description: | ATG4 autophagy related 4 homolog D (S. cerevisiae) |
| Synonyms: | cysteine protease ATG4D; APG4-D; APG4D; AUTL4; APG4 autophagy 4 homolog D; ATG4 autophagy related 4 homolog D; AUT-like 4 cysteine endopeptidase; autophagin-4; autophagy-related cysteine endopeptidase 4; autophagy-related protein 4 homolog D; cysteine protease involved in autophagy; autophagy related 4D cysteine peptidase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtgggaaaccgcgacactcactgtacttcattggctaccaagatgacttcctgctgtacctggaccctcactactgccagcccactgtggatgtcagccaggccgacttccccctggagtccttccactgcacctcgccccgcaagatggcctttgccaagatggacccaagctgtaccgtgggcttctatgctggagacaggaaggagtttgagacactctgctcagagctgaccagggtcctcagctcctcctcagccacagagcggtaccccatgttcaccctggccgagggccatgctcaggaccacagcctggacgacctctgctcccagctcgcccagcccacactccggctccctcgcacagggcggctcctcagggccaaacgccccagctctgaggactttgtgtttttataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - adaptor-related protein complex 2, sigma 1 subunit - adaptor-related protein complex 1, sigma 3 subunit - centrin, EF-hand protein, 3 (CDC31 homolog, yeast) - CCHC-type zinc finger, nucleic acid binding protein |