Cart 8 Product Products 926,21 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 € -
1 x ARMCX3-arm...121,50 € -
1 x RRP15-ribo...113,40 € -
1 x RBMS3-RNA...121,50 € -
1 x CCR1-chemo...121,50 €
No products
To be determined Shipping
926,21 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 926,21 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 926,21 €
View larger 
Data sheet of SEDLP-spondyloepiphyseal dysplasia, late, pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SEDLP-spondyloepiphyseal dysplasia, late, pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008889 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SEDLP |
| Origin species: | Human |
| Product name: | SEDLP-spondyloepiphyseal dysplasia, late, pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC008889 |
| Gene id: | 10597 |
| Gene description: | spondyloepiphyseal dysplasia, late, pseudogene |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggaagcttctactttgtaattgttggtcaccatgataatccagtttttgaaatggagtttttgccagctgggaaggcagaatccaaagacgaccatcgtcatctgaaccagttcatagctcatgctgctctcgacctcgtagatgagaacatgtggctgtcgaacaacatgtacttgaaaactgtggacaagttcaacgagtggtttgtgtcagcatttgtcaccgcggggcatatgaggtttattatgcttcatgacataagacaagaagatggaataaagaacttctttactgatgtttatgatttatatataaaattttcaatgaatccattttatgaacccaattctcctattcgatcaagtgcatttgacagaaaagttcagtttcttgggaagaaacaccttttaagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 15 - alanine-glyoxylate aminotransferase 2-like 2 - protein tyrosine phosphatase, mitochondrial 1 - ubiquitin specific peptidase 6 (Tre-2 oncogene) |