Cart 11 Product Products 1 271,70 € (empty)
-
1 x GRIN2C-glu...113,40 € -
1 x RPL27-ribo...113,40 € -
1 x GPX1-gluta...113,40 € -
1 x C6orf159-c...113,40 € -
1 x TNNT3-trop...113,40 € -
1 x CCDC42-coi...113,40 € -
1 x C4orf29-ch...121,50 € -
1 x CADM3-cell...121,50 € -
1 x LOC595101-...113,40 € -
1 x PRDM5-PR...113,40 € -
1 x REM2-RAS...121,50 €
No products
To be determined Shipping
1 271,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 271,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 271,70 €
Data sheet of HRSP12-heat-responsive protein 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HRSP12-heat-responsive protein 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010280 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HRSP12 |
| Origin species: | Human |
| Product name: | HRSP12-heat-responsive protein 12 Gene |
| Size: | 2ug |
| Accessions: | BC010280 |
| Gene id: | 10247 |
| Gene description: | heat-responsive protein 12 |
| Synonyms: | HRSP12; P14.5; PSP; UK114; ribonuclease UK114; 14.5 kDa translational inhibitor protein; UK114 antigen homolog; heat-responsive protein 12; perchloric acid-soluble protein; translational inhibitor p14.5; translational inhibitor protein p14.5; reactive intermediate imine deaminase A homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtccttgatcagaagggtgatcagcaccgcgaaagccccaggggccattggaccctacagtcaagctgtattagtcgacaggaccatttacatttcaggacagataggcatggacccttcaagtggacagcttgtgtcaggaggggtagcagaagaagctaaacaagctcttaaaaacatgggtgaaattctgaaagctgcaggctgtgacttcactaacgtggtgaaaacaactgttcttctggctgacataaatgacttcaatactgtcaatgaaatctacaaacagtatttcaagagtaattttcctgctagagctgcttaccaagttgctgctttacccaaaggcagccgaattgaaattgaagcagtagctatccaaggaccactgacaacggcatcactataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 128 - mediator complex subunit 21 - M-phase phosphoprotein 6 - thymocyte nuclear protein 1 |