RPL28-ribosomal protein L28 Gene

View larger

RPL28-ribosomal protein L28 Gene

Reference: PTXBC010182

Condition: New product

Print

Data sheet of RPL28-ribosomal protein L28 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about RPL28-ribosomal protein L28 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC010182
Product type:	DNA & cDNA
Ncbi symbol:	RPL28
Origin species:	Human
Product name:	RPL28-ribosomal protein L28 Gene
Size:	2ug
Accessions:	BC010182
Gene id:	6158
Gene description:	ribosomal protein L28
Synonyms:	L28; 60S ribosomal protein L28; ribosomal protein L28
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtctgcgcatctgcaatggatggtcgtgcggaactgctccagtttcctgatcaagaggaataagcagacctacagcactgagcccaataacttgaaggcccgcaattccttccgctacaacggactgattcaccgcaagactgtgggcgtggagccggcagccgacggcaaaggtgtcgtggtggtcattaagcggagatccggccagcggaagcctgccacctcctatgtgcggaccaccatcaacaggaatgctcgcgccacgctcagcagcatcagacacatgatccgcaagaacaagtaccgccccgacctgcgcatggcagccatccgcagggccagcgccatcctgcgcagccagaagcctgtgatggtgaagaggaagcggacccgccccaccaagagctcctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- ribosomal protein S16 - ribosomal protein S14 - MYC associated factor X - MYC associated factor X

Reviews

Be the first to write your review !

Buy RPL28-ribosomal protein L28 Gene now