Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DCUN1D1-DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) Gene
PTXBC013163
New product
Data sheet of DCUN1D1-DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCUN1D1-DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013163 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCUN1D1 |
| Origin species: | Human |
| Product name: | DCUN1D1-DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC013163 |
| Gene id: | 54165 |
| Gene description: | DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) |
| Synonyms: | DCNL1; DCUN1L1; RP42; SCCRO; SCRO; Tes3; DCN1-like protein 1; DCN1, defective in cullin neddylation 1, domain containing 1; DCUN1 domain-containing protein 1; RP42 homolog; defective in cullin neddylation protein 1-like protein 1; squamous cell carcinoma-related oncogene; defective in cullin neddylation 1 domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatggcatgacagaattaggatgtgacagcatagaaaaactaaaggcccagatacccaagatggaacaagaattgaaagaaccaggacgatttaaggatttttaccagtttacttttaattttgcaaagaatccaggacaaaaaggattagatctagaaatggccattgcctactggaacttagtgcttaatggaagatttaaattcttagacttatggaataaatttttgttggaacatcataaacgatcaataccaaaagacacttggaatcttcttttagacttcagtacgatgattgcagatgacatgtctaattatgatgaagaaggagcatggcctgttcttattgatgactttgtggaatttgcacgccctcaaattgctgggacaaaaagtacaacagtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa - platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa - TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa - TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa |