Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FABP4-fatty acid binding protein 4, adipocyte Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FABP4-fatty acid binding protein 4, adipocyte Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003672 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FABP4 |
| Origin species: | Human |
| Product name: | FABP4-fatty acid binding protein 4, adipocyte Gene |
| Size: | 2ug |
| Accessions: | BC003672 |
| Gene id: | 2167 |
| Gene description: | fatty acid binding protein 4, adipocyte |
| Synonyms: | A-FABP; AFABP; ALBP; HEL-S-104; aP2; fatty acid-binding protein, adipocyte; adipocyte fatty acid binding protein; adipocyte lipid-binding protein; adipocyte-type fatty acid-binding protein; epididymis secretory protein Li 104; fatty acid binding protein 4, adipocyte; fatty acid binding protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtgatgcttttgtaggtacctggaaacttgtctccagtgaaaactttgatgattatatgaaagaagtaggagtgggctttgccaccaggaaagtggctggcatggccaaacctaacatgatcatcagtgtgaatggggatgtgatcaccattaaatctgaaagtacctttaaaaatactgagatttccttcatactgggccaggaatttgacgaagtcactgcagatgacaggaaagtcaagagcaccataaccttagatgggggtgtcctggtacatgtgcagaaatgggatggaaaatcaaccaccataaagagaaaacgagaggatgataaactggtggtggaatgcgtcatgaaaggcgtcacttccacgagagtttatgagagagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aminoadipate-semialdehyde dehydrogenase - NFKB inhibitor interacting Ras-like 1 - DNA-damage-inducible transcript 4-like - synaptosomal-associated protein, 25kDa |