Cart 1 Product Products 113,40 € (empty)
-
1 x LZIC-leuci...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of TPD52L3-tumor protein D52-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPD52L3-tumor protein D52-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017589 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPD52L3 |
| Origin species: | Human |
| Product name: | TPD52L3-tumor protein D52-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC017589 |
| Gene id: | 89882 |
| Gene description: | tumor protein D52-like 3 |
| Synonyms: | NYDSP25; tumor protein D55; protein kinase NYD-SP25; testis development protein NYD-SP25; testis tissue sperm-binding protein Li 87P; tumor protein D52 like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccacatgccaggacagagacctctgtgggcacatatgaatcccactcgacttctgaactggaggatctgacagagcccgagcaaagagagctcaaaaccaaactcactaaattggaggctgaaattgtaaccctacgccacgtactagcagccaaagagagacgctgtggggaactcaagaggaagttaggcctcaccgccttggtagggctgagacagaatctgtccaagagctggcttgatgttcaggtctccaacacctatgtgaaacagaagacatcagctgctctgtccaccatgggcactctcatctgcaggaagcttggaggcgtgaagaagtcggccacactcagatcttttgaaggaaaccctaaaggagaaggaagcagaatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peripheral myelin protein 2 - immunoglobulin lambda locus - serine/threonine kinase 10 - H1 histone family, member 0 |