Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPAG9-sperm associated antigen 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPAG9-sperm associated antigen 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007524 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPAG9 |
| Origin species: | Human |
| Product name: | SPAG9-sperm associated antigen 9 Gene |
| Size: | 2ug |
| Accessions: | BC007524 |
| Gene id: | 9043 |
| Gene description: | sperm associated antigen 9 |
| Synonyms: | CT89; HLC-6; HLC4; HLC6; JIP-4; JIP4; JLP; PHET; PIG6; C-Jun-amino-terminal kinase-interacting protein 4; JNK interacting protein; JNK/SAPK-associated protein; Max-binding protein; c-Jun NH2-terminal kinase-associated leucine zipper protein; cancer/testis antigen 89; human lung cancer oncogene 6 protein; lung cancer oncogene 4; mitogen-activated protein kinase 8-interacting protein 4; proliferation-inducing gene 6; protein highly expressed in testis; sperm associated antigen 9 variant 5; sperm surface protein; sunday driver 1; sperm associated antigen 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtcctggatgcatgctgctgtttgtgtttggctttgttggcggggcggtggtcattaattctgctatcttagtatctctctctgttttgctgcttgtgcacttttctatttctaccggtgtgccagctctgacgcagaacctaccaaggatactcagaaaagaacgccctatatcattaggaattttcccattacctgctggagatggattgcttacacctgatgctcagaaaggaggagagacccctggatctgagcaatggaaatttcaggaattaagtcaaccacgttctcataccagcctgaaggtcagcaatagtcctgaacctcagaaggctgtagaacaggaggtgagaatggtgcttcttaacattttgcaaaaagtatactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor protein D52-like 3 - peripheral myelin protein 2 - immunoglobulin lambda locus - serine/threonine kinase 10 |