MIA-melanoma inhibitory activity Gene View larger

MIA-melanoma inhibitory activity Gene

PTXBC005910

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MIA-melanoma inhibitory activity Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MIA-melanoma inhibitory activity Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005910
Product type: DNA & cDNA
Ncbi symbol: MIA
Origin species: Human
Product name: MIA-melanoma inhibitory activity Gene
Size: 2ug
Accessions: BC005910
Gene id: 8190
Gene description: melanoma inhibitory activity
Synonyms: CD-RAP; melanoma-derived growth regulatory protein; melanoma inhibitory activity
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccggtccctggtgtgccttggtgtcatcatcttgctgtctgccttctccggacctggtgtcaggggtggtcctatgcccaagctggctgaccggaagctgtgtgcggaccaggagtgcagccaccctatctccatggctgtggcccttcaggactacatggcccccgactgccgattcctgaccattcaccggggccaagtggtgtatgtcttctccaagctgaagggccgtgggcggctcttctggggaggcagcgttcagggagattactatggagatctggctgctcgcctgggctatttccccagtagcattgtccgagaggaccagaccctgaaacctggcaaagtcgatgtgaagacagacaaatgggatttctactgccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sperm associated antigen 9
- tumor protein D52-like 3
- peripheral myelin protein 2
- immunoglobulin lambda locus

Reviews

Buy MIA-melanoma inhibitory activity Gene now

Add to cart