PTXBC022013
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC022013 |
Product type: | DNA & cDNA |
Ncbi symbol: | LOC541473 |
Origin species: | Human |
Product name: | LOC541473-FK506 binding protein 6, 36kDa pseudogene Gene |
Size: | 2ug |
Accessions: | BC022013 |
Gene id: | 541473 |
Gene description: | FK506 binding protein 6, 36kDa pseudogene |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggggggaagcgcgttaaaccagggagtcctggaaggggacgacgcccccggccagtccctgtacgagcggttaagtcagaggatgctggacatctcgggggaccggggcgtgctgaaggacgtcatccgagaaggagctggagacctagtggcgcctgatgcttcggtgctagtgaaatactatggatacctggaacacttggacagacccttcgattctaattactttaggaaaactcctcggctaatgaaacttggagaggatattacattgtggggcatggagctgggccttctgagcatgcagagaggagagctggccagatgcttcgtcttgggtaaactcctcgactcccaaggccccagcctccatctttacctcagagcctcctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - ribonuclease, RNase A family, 1 (pancreatic) - neuroblastoma, suppression of tumorigenicity 1 - family with sequence similarity 98, member C - MAD2 mitotic arrest deficient-like 2 (yeast) |