PTXBC007793
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007793 |
Product type: | DNA & cDNA |
Ncbi symbol: | GEMIN7 |
Origin species: | Human |
Product name: | GEMIN7-gem (nuclear organelle) associated protein 7 Gene |
Size: | 2ug |
Accessions: | BC007793 |
Gene id: | 79760 |
Gene description: | gem (nuclear organelle) associated protein 7 |
Synonyms: | SIP3; gem-associated protein 7; gemin-7; gem nuclear organelle associated protein 7 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcaaactccagtgaacattcccgtgcctgtgctccggctgccccggggccctgatggcttcagccgtggctttgcccctgatggacgcagagcccccttgaggccagaggttcctgaaatccaggagtgtcccatagctcaagaatccctggaatcccaggagcagcgggcacgagccgcccttcgggagcgttacctccgcagcctgctggccatggtgggtcatcaggtgagcttcacgttgcacgagggtgtgcgtgtggccgcccactttggagccaccgacctggatgtggccaacttctacgtgtcacagctgcagactcccataggtgtgcaagcagaggcgctgctccgatgtagtgacattatttcatataccttcaagccataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - FK506 binding protein 6, 36kDa pseudogene - ribonuclease, RNase A family, 1 (pancreatic) - neuroblastoma, suppression of tumorigenicity 1 - family with sequence similarity 98, member C |