Cart 37 Product Products 4 284,20 € (empty)
-
1 x CHMP6-chro...113,40 € -
-
1 x KRR1-KRR1,...121,50 € -
1 x PVRL3-poli...121,50 € -
1 x SLC22A24-s...121,50 € -
1 x CTSE-cathe...121,50 € -
-
-
1 x CD34-CD34...121,50 € -
1 x NINJ2-ninj...113,40 € -
1 x MFSD5-majo...121,50 € -
-
-
1 x TWSG1-twis...113,40 € -
1 x PSPC1-para...121,50 € -
1 x FNTA-farne...113,40 € -
1 x FANCA-Fanc...121,50 € -
1 x OSBPL1A-ox...121,50 € -
1 x CHKB-choli...121,50 € -
-
-
1 x TPI1-trios...113,40 € -
-
-
1 x UBE2D4-ubi...113,40 € -
1 x ZCCHC10-zi...113,40 € -
1 x SQRDL-sulf...121,50 € -
1 x ADCYAP1R1-...121,50 € -
-
-
1 x BAAT-bile...121,50 € -
1 x GYG1-glyco...121,50 € -
-
-
1 x KCNAB3-pot...121,50 € -
1 x RPL15-ribo...113,40 € -
No products
To be determined Shipping
4 284,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 37 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 284,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 284,20 €
View larger 
TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene
PTXBC002718
New product
Data sheet of TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002718 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF12A |
| Origin species: | Human |
| Product name: | TNFRSF12A-tumor necrosis factor receptor superfamily, member 12A Gene |
| Size: | 2ug |
| Accessions: | BC002718 |
| Gene id: | 51330 |
| Gene description: | tumor necrosis factor receptor superfamily, member 12A |
| Synonyms: | CD266; FN14; TWEAKR; tumor necrosis factor receptor superfamily member 12A; FGF-inducible 14; fibroblast growth factor-inducible immediate-early response protein 14; tweak-receptor; type I transmembrane protein Fn14; TNF receptor superfamily member 12A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcggggctcgctgcgccggttgctgcggctcctcgtgctggggctctggctggcgttgctgcgctccgtggccggggagcaagcgccaggcaccgccccctgctcccgcggcagctcctggagcgcggacctggacaagtgcatggactgcgcgtcttgcagggcgcgaccgcacagcgacttctgcctgggctgcgctgcagcacctcctgcccccttccggctgctttggcccatccttgggggcgctctgagcctgaccttcgtgctggggctgctttctggctttttggtctggagacgatgccgcaggagagagaagttcaccacccccatagaggagaccggcggagagggctgcccagctgtggcgctgatccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin, light chain 6, alkali, smooth muscle and non-muscle - asparagine-linked glycosylation 13 homolog (S. cerevisiae) - heat shock 27kDa protein family, member 7 (cardiovascular) - thioredoxin domain containing 12 (endoplasmic reticulum) |