H2AFJ-H2A histone family, member J Gene View larger

H2AFJ-H2A histone family, member J Gene

PTXBC003602

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of H2AFJ-H2A histone family, member J Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about H2AFJ-H2A histone family, member J Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003602
Product type: DNA & cDNA
Ncbi symbol: H2AFJ
Origin species: Human
Product name: H2AFJ-H2A histone family, member J Gene
Size: 2ug
Accessions: BC003602
Gene id: 55766
Gene description: H2A histone family, member J
Synonyms: H2AJ; histone H2A.J; H2a/j; buforin I; H2A histone family member J
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccggtcgcgggaaacagggcggcaaagtgcgagcaaaggccaaatcccgctcctcccgcgcgggcctgcagttcccggtgggccgagtgcacagactgctgcgcaaagggaactacgcggagcgagtgggcgccggggcgccggtgtacctggcggcggtgttggagtaccttacggcggagatcctggagctggctggcaacgccgcgcgtgacaacaagaagaccaggataattccccgccacctgcagctcgccatccgcaacgacgaggagttaaacaagctgctgggcaaagtgaccatcgctcagggcggcgtcctgcccaacatccaggccgtgctgctgcccaagaagacggagagtcagaagacgaagagcaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ORM1-like 1 (S. cerevisiae)
- peripheral myelin protein 22
- serine/threonine kinase 32A
- RNA binding motif protein 8A

Reviews

Buy H2AFJ-H2A histone family, member J Gene now

Add to cart