> >>EGLN1-egl nine homolog 1 (C. elegans) Gene
EGLN1-egl nine homolog 1 (C. elegans) Gene View larger

EGLN1-egl nine homolog 1 (C. elegans) Gene

PTXBC005369

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of EGLN1-egl nine homolog 1 (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EGLN1-egl nine homolog 1 (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005369
Product type: DNA & cDNA
Ncbi symbol: EGLN1
Origin species: Human
Product name: EGLN1-egl nine homolog 1 (C. elegans) Gene
Size: 2ug
Accessions: BC005369
Gene id: 54583
Gene description: egl nine homolog 1 (C. elegans)
Synonyms: C1orf12; ECYT3; HALAH; HIF-PH2; HIFPH2; HPH-2; HPH2; PHD2; SM20; ZMYND6; egl nine homolog 1; HIF-prolyl hydroxylase 2; egl nine-like protein 1; hypoxia-inducible factor prolyl hydroxylase 2; prolyl hydroxylase domain-containing protein 2; zinc finger MYND domain-containing protein 6; egl-9 family hypoxia inducible factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattgaacccaaatttgatagactgctgtttttctggtctgaccgtcgcaaccctcatgaagtacaaccagcatatgctacaaggtacgcaataactgtttggtattttgatgcagatgagagagcacgagctaaagtaaaatatctaacaggtgaaaaaggtgtgagggttgaactcaataaaccttcagattcggtcggtaaagacgtcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c oxidase subunit Vb
- chemokine (C-C motif) ligand 21
- PYD and CARD domain containing
- dynein, axonemal, light chain 1

Reviews

Buy EGLN1-egl nine homolog 1 (C. elegans) Gene now

Add to cart