Cart 23 Product Products 3 048,47 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 € -
1 x UBL5-ubiqu...113,40 € -
1 x RPL23A-rib...113,40 € -
1 x ZNF266-zin...113,40 € -
1 x PGDS-prost...113,40 € -
1 x DLX6-dista...113,40 € -
-
1 x ANKRD22-an...113,40 € -
1 x SSSCA1-Sjo...113,40 € -
1 x SMAP2-smal...121,50 € -
1 x H2AFX-H2A...113,40 € -
1 x CRTAM-cyto...121,50 € -
1 x RPLP2-ribo...113,40 € -
No products
To be determined Shipping
3 048,47 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 048,47 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 048,47 €
View larger 
Data sheet of PTPRS-protein tyrosine phosphatase, receptor type, S Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPRS-protein tyrosine phosphatase, receptor type, S Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029496 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPRS |
| Origin species: | Human |
| Product name: | PTPRS-protein tyrosine phosphatase, receptor type, S Gene |
| Size: | 2ug |
| Accessions: | BC029496 |
| Gene id: | 5802 |
| Gene description: | protein tyrosine phosphatase, receptor type, S |
| Synonyms: | PTPSIGMA; R-PTP-S; R-PTP-sigma; receptor-type tyrosine-protein phosphatase S; protein tyrosine phosphatase PTPsigma; receptor-type tyrosine-protein phosphatase sigma; protein tyrosine phosphatase, receptor type S |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcccacctggggccctggcatggtgtctgtggttggtcccatgggcctccttgtggtcctgctcgttggaggctgtgcagcagaagagccccccaggtttatcaaagaacccaaggaccagatcggcgtgtcggggggtgtggcctctttcgtgtgtcaggccacgggtgaccccaagccacgagtgacctggaacaagaagggcaagaaggtcaactctcagcgctttgagacgattgagtttgatgagagtgccggggcagtgctgaggatccagccgctgaggacaccgcgggatgaaaacgtgtacgagtgtgtggcccagaactcggttggggagatcacagtccatgccaagcttactgtcctccgaggaccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spondyloepiphyseal dysplasia, late, pseudogene - DnaJ (Hsp40) homolog, subfamily C, member 15 - alanine-glyoxylate aminotransferase 2-like 2 - protein tyrosine phosphatase, mitochondrial 1 |