Cart 1 Product Products 544,00 € (empty)
-
1 x C-Reactive...544,00 €
No products
To be determined Shipping
544,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 544,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 544,00 €
Data sheet of EGLN2-egl nine homolog 2 (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EGLN2-egl nine homolog 2 (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001723 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EGLN2 |
| Origin species: | Human |
| Product name: | EGLN2-egl nine homolog 2 (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC001723 |
| Gene id: | 112398 |
| Gene description: | egl nine homolog 2 (C. elegans) |
| Synonyms: | EIT6; HIF-PH1; HIFPH1; HPH-1; HPH-3; PHD1; egl nine homolog 2; HIF-prolyl hydroxylase 1; estrogen-induced tag 6; hypoxia-inducible factor prolyl hydroxylase 1; prolyl hydroxylase domain-containing protein 1; egl-9 family hypoxia inducible factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggcgtgttacccaggcaacgggctcgggtacgtaaggcacgttgacaatccccacggcgatgggcgctgcatcacctgtatctattacctgaatcagaactgggacgttaaggtgcatggcggcctgctgcagatcttccctgagggccggcccgtggtagccaacatcgagccactctttgaccggttgctcattttctggtctgaccggcggaacccccacgaggtgaagccagcctatgccaccaggtacgccatcactgtctggtattttgatgccaaggagcgggcagcagccaaagacaagtatcagctagcatcaggacagaaaggtgtccaagtacctgtatcacagccgcctacgcccacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - egl nine homolog 1 (C. elegans) - cytochrome c oxidase subunit Vb - chemokine (C-C motif) ligand 21 - PYD and CARD domain containing |