> >>PHPT1-phosphohistidine phosphatase 1 Gene
PHPT1-phosphohistidine phosphatase 1 Gene View larger

PHPT1-phosphohistidine phosphatase 1 Gene

PTXBC024648

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PHPT1-phosphohistidine phosphatase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PHPT1-phosphohistidine phosphatase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024648
Product type: DNA & cDNA
Ncbi symbol: PHPT1
Origin species: Human
Product name: PHPT1-phosphohistidine phosphatase 1 Gene
Size: 2ug
Accessions: BC024648
Gene id: 29085
Gene description: phosphohistidine phosphatase 1
Synonyms: CGI-202; HEL-S-132P; HSPC141; PHP; PHP14; 14 kDa phosphohistidine phosphatase; epididymis secretory sperm binding protein Li 132P; protein histidine phosphatase; protein janus-A homolog; sex-regulated protein janus-a; phosphohistidine phosphatase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtggcggacctcgctctcattcctgatgtggacatcgactccgacggcgtcttcaagtatgtgctgatccgagtccactcggctccccgctccggggctccggctgcagagagcaaggagatcgtgcgcggctacaagtgggctgagtaccatgcggacatctacgacaaagtgtcgggcgacatgcagaagcaaggctgcgactgtgagtgtctgggcggcgggcgcatctcccaccagagtcaggacaagaagattcacgtgtacggctattccatggcctatggtcctgcccagcacgccatttcaactgagaaaatcaaagccaagtaccccgactacgaggtcacctgggctaacgacggctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - jumping translocation breakpoint
- glycophorin A (MNS blood group)
- glycophorin A (MNS blood group)
- natriuretic peptide precursor A

Reviews

Buy PHPT1-phosphohistidine phosphatase 1 Gene now

Add to cart