Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IFI27-interferon, alpha-inducible protein 27 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFI27-interferon, alpha-inducible protein 27 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015492 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFI27 |
| Origin species: | Human |
| Product name: | IFI27-interferon, alpha-inducible protein 27 Gene |
| Size: | 2ug |
| Accessions: | BC015492 |
| Gene id: | 3429 |
| Gene description: | interferon, alpha-inducible protein 27 |
| Synonyms: | FAM14D; ISG12; ISG12A; P27; interferon alpha-inducible protein 27, mitochondrial; 2310061N23Rik; ISG12(a); interferon alpha-induced 11.5 kDa protein; interferon-stimulated gene 12a protein; interferon alpha inducible protein 27 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcctctgctctcacctcatcagcagtgaccagtgtggccaaagtggtcagggtggcctctggctctgccgtagttttgcccctggccaggattgctacagttgtgattggaggagttgtggctgtgcccatggtgctcagtgccatgggcttcactgcggcgggaatcgcctcgtcctccatagcagccaagatgatgtccgcggcggccattgccaatgggggtggagttgcctcgggcagccttgtggctactctgcagtcactgggagcaactggactctccggattgaccaagttcatcctgggctccattgggtctgccattgcggctgtcattgcgaggttctactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 20 open reading frame 30 - chromosome 20 open reading frame 30 - chromosome 11 open reading frame 51 - rhomboid, veinlet-like 2 (Drosophila) |