Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene
PTXBC008452
New product
Data sheet of ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008452 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1G1 |
| Origin species: | Human |
| Product name: | ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene |
| Size: | 2ug |
| Accessions: | BC008452 |
| Gene id: | 9550 |
| Gene description: | ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 |
| Synonyms: | ATP6G; ATP6G1; ATP6GL; ATP6J; Vma10; V-type proton ATPase subunit G 1; ATPase, H+ transporting, lysosomal (vacuolar proton pump), member J; ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1; V-ATPase 13 kDa subunit 1; V-ATPase subunit G 1; vacuolar ATP synthase subunit M16; vacuolar H(+)-ATPase subunit G 1; vacuolar proton pump subunit G 1; vacuolar proton pump subunit M16; ATPase H+ transporting V1 subunit G1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctagtcagtctcaggggattcagcagctgctgcaggccgagaagcgggcagccgagaaggtgtccgaggcccgcaaaagaaagaaccggaggctgaagcaggccaaagaagaagctcaggctgaaattgaacagtaccgcctgcagagggagaaagaattcaaggccaaggaagctgcggcattgggatcccgtggcagttgcagcactgaagtggagaaggagacccaggagaagatgaccatcctccagacatacttccggcagaacagggatgaagtcttggacaacctcttggcttttgtctgtgacattcggccagaaatccatgaaaactaccgcataaatggatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LysM, putative peptidoglycan-binding, domain containing 2 - tumor necrosis factor receptor superfamily, member 12A - myosin, light chain 6, alkali, smooth muscle and non-muscle - asparagine-linked glycosylation 13 homolog (S. cerevisiae) |