GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene View larger

GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene

PTXBC005985

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005985
Product type: DNA & cDNA
Ncbi symbol: GABARAPL2
Origin species: Human
Product name: GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene
Size: 2ug
Accessions: BC005985
Gene id: 11345
Gene description: GABA(A) receptor-associated protein-like 2
Synonyms: ATG8; ATG8C; GATE-16; GATE16; GEF-2; GEF2; gamma-aminobutyric acid receptor-associated protein-like 2; GABA(A) receptor-associated protein-like 2; MAP1 light chain 3 related protein; ganglioside expression factor 2; general protein transport factor p16; golgi-associated ATPase enhancer of 16 kDa; GABA type A receptor associated protein like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtggatgttcaaggaggaccactcgctggaacacagatgcgtggagtccgcgaagattcgagcgaaatatcccgacagggttccggtgattgtggaaaaggtctcaggctctcagattgttgacattgacaaacggaagtacttggttccatctgatatcactgtggctcagttcatgtggatcatcaggaaaaggatccagcttccttctgaaaaggcgatcttcctgtttgtggataagacagtcccacagtccagcctaactatgggacagctttacgagaaggaaaaagatgaagatggattcttatatgtggcctacagcggagagaacacttttggcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein tyrosine phosphatase, receptor type, S
- spondyloepiphyseal dysplasia, late, pseudogene
- DnaJ (Hsp40) homolog, subfamily C, member 15
- alanine-glyoxylate aminotransferase 2-like 2

Reviews

Buy GABARAPL2-GABA(A) receptor-associated protein-like 2 Gene now

Add to cart