Cart 4 Product Products 411,12 € (empty)
No products
To be determined Shipping
411,12 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 411,12 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 411,12 €
View larger 
SMCP-sperm mitochondria-associated cysteine-rich protein Gene
PTXBC014593
New product
Data sheet of SMCP-sperm mitochondria-associated cysteine-rich protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMCP-sperm mitochondria-associated cysteine-rich protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014593 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMCP |
| Origin species: | Human |
| Product name: | SMCP-sperm mitochondria-associated cysteine-rich protein Gene |
| Size: | 2ug |
| Accessions: | BC014593 |
| Gene id: | 4184 |
| Gene description: | sperm mitochondria-associated cysteine-rich protein |
| Synonyms: | HSMCSGEN1; MCS; MCSP; sperm mitochondrial-associated cysteine-rich protein; mitochondrial capsule selenoprotein; testicular tissue protein Li 119; testicular tissue protein Li 161; sperm mitochondria associated cysteine rich protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtgaccagacaaaacacagtaaatgctgcccagcaaaaggcaatcaatgctgcccaccacagcagaaccagtgctgccagtcaaaaggcaatcaatgctgcccaccaaaacagaaccagtgctgccagccaaaaggcagtcaatgctgcccaccaaaacacaatcactgctgccagccaaaacccccatgctgcattcaggccaggtgctgtggtttggagaccaagcctgaagtctcaccccttaacatggagtctgagcccaactcaccgcaaactcaggacaagggctgtcaaacccagcagcagccccatagcccacaaaatgagtccaggccaagcaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATG4 autophagy related 4 homolog D (S. cerevisiae) - adaptor-related protein complex 2, sigma 1 subunit - adaptor-related protein complex 1, sigma 3 subunit - centrin, EF-hand protein, 3 (CDC31 homolog, yeast) |