PTXBC013744
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC013744 |
Product type: | DNA & cDNA |
Ncbi symbol: | CXCL6 |
Origin species: | Human |
Product name: | CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene |
Size: | 2ug |
Accessions: | BC013744 |
Gene id: | 6372 |
Gene description: | chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) |
Synonyms: | CKA-3; GCP-2; GCP2; SCYB6; C-X-C motif chemokine 6; Small inducible cytokine subfamily B (Cys-X-Cys), member b; chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2); chemokine alpha 3; granulocyte chemotactic protein 2; small inducible cytokine subfamily B (Cys-X-Cys), member 6 (granulocyte chemotactic protein 2); small-inducible cytokine B6; C-X-C motif chemokine ligand 6 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgagcctcccgtccagccgcgcggcccgtgtcccgggtccttcgggctccttgtgcgcgctgctcgcgctgctgctcctgctgacgccgccggggcccctcgccagcgctggtcctgtctctgctgtgctgacagagctgcgttgcacttgtttacgcgttacgctgagagtaaaccccaaaacgattggtaaactgcaggtgttccccgcaggcccgcagtgctccaaggtggaagtggtagcctccctgaagaacgggaagcaagtttgtctggacccggaagccccttttctaaagaaagtcatccagaaaattttggacagtggaaacaagaaaaactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - inhibitor of DNA binding 2, dominant negative helix-loop-helix protein - succinate dehydrogenase complex, subunit D, integral membrane protein - RNA binding motif protein, Y-linked, family 2, member F pseudogene - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) |