Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ABHD12B-abhydrolase domain containing 12B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ABHD12B-abhydrolase domain containing 12B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034603 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ABHD12B |
| Origin species: | Human |
| Product name: | ABHD12B-abhydrolase domain containing 12B Gene |
| Size: | 2ug |
| Accessions: | BC034603 |
| Gene id: | 145447 |
| Gene description: | abhydrolase domain containing 12B |
| Synonyms: | protein ABHD12B; BEM46L3; C14orf29; c14_5314; abhydrolase domain-containing protein 12B; alpha/beta hydrolase domain-containing protein 12B; abhydrolase domain containing 12B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggttgcaagtatcaattatcccttgttaaagatttaccggaacattccaggatttttacgtacacttatggatgccctgagaaaagacaaaataatctttcctaatgatgaaaatgttaaattcctttcttctcctcttctcatcttacatggagaggatgacaggacagtgcctttggagtatgggaaaaagctctatgaaattgcacgcaatgcatacaggaacaaagagagggtcaagatggttatctttcctcctggcttccaacacaacctgctttgtaaaagccccacactgttaataaccgtgagagatttcctgagcaagcagtggtcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 115 - damage-regulated autophagy modulator - hypothetical protein MGC34034 - coiled-coil domain containing 108 |