Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RNF7-ring finger protein 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF7-ring finger protein 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005966 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF7 |
| Origin species: | Human |
| Product name: | RNF7-ring finger protein 7 Gene |
| Size: | 2ug |
| Accessions: | BC005966 |
| Gene id: | 9616 |
| Gene description: | ring finger protein 7 |
| Synonyms: | CKBBP1; ROC2; SAG; RING-box protein 2; CKII beta-binding protein 1; rbx2; regulator of cullins 2; sensitive to apoptosis gene protein; sensitive to apoptosis, zinc RING finger protein SAG, regulator of cullins 2; zinc RING finger protein SAG; ring finger protein 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgacgtggaagacggagaggaaacctgcgccctggcctctcactccgggagctcaggctccaagtcgggaggcgacaagatgttctccctcaagaagtggaacgcggtcgccatgtggagctgggacgtggagtgcgatacgtgcgccatctgcagggtccaggtgatggatgcctgtcttagatgtcaagctgaaaacaaacaagaggactgtgttgtggtctggggagaatgtaatcattccttccacaactgctgcatgtccctgtgggtgaaacagaacaatcgctgccctctctgccagcaggactgggtggtccaaagaatcggcaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centromere protein A - chemokine-like factor - crystallin, beta A2 - nucleolar protein 12 |