Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of KIAA0101-KIAA0101 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA0101-KIAA0101 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005832 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA0101 |
| Origin species: | Human |
| Product name: | KIAA0101-KIAA0101 Gene |
| Size: | 2ug |
| Accessions: | BC005832 |
| Gene id: | 9768 |
| Gene description: | KIAA0101 |
| Synonyms: | KIAA0101; NS5ATP9; OEATC; OEATC-1; OEATC1; PAF; PAF15; p15(PAF); p15/PAF; p15PAF; PCNA-associated factor; HCV NS5A-transactivated protein 9; PCNA-associated factor of 15 kDa; hepatitis C virus NS5A-transactivated protein 9; overexpressed in anaplastic thyroid carcinoma 1; PCNA clamp associated factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgcggactaaagcagacagtgttccaggcacttacagaaaagtggtggctgctcgagcccccagaaaggtgcttggttcttccacctctgccactaattcgacatcagtttcatcgaggaaagctgaaaataaatatgcaggagggaaccccgtttgcgtgcgcccaactcccaagtggcaaaaaggaattggagaattctttaggttgtcccctaaagattctgaaaaagagaatcagattcctgaagaggcaggaagcagtggcttaggaaaagcaaagagaaaagcatgtcctttgcaacctgatcacacaaatgatgaaaaagaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G antigen 5 - transthyretin - KIAA1143 - complexin 3 |