Cart 8 Product Products 1 230,80 € (empty)
-
-
1 x ZBTB43-zin...121,50 € -
1 x BCAT2-bran...121,50 € -
1 x FLJ32063-h...113,40 € -
1 x LSM2-LSM2...113,40 € -
1 x THEX1-thre...121,50 € -
-
1 x SIAH1-seve...121,50 €
No products
To be determined Shipping
1 230,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 230,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 230,80 €
Data sheet of PHF5A-PHD finger protein 5A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PHF5A-PHD finger protein 5A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007321 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PHF5A |
| Origin species: | Human |
| Product name: | PHF5A-PHD finger protein 5A Gene |
| Size: | 2ug |
| Accessions: | BC007321 |
| Gene id: | 84844 |
| Gene description: | PHD finger protein 5A |
| Synonyms: | INI; Rds3; SAP14b; SF3B7; SF3b14b; bK223H9.2; PHD finger-like domain-containing protein 5A; PHD finger-like domain protein 5A; PHD-finger 5a; splicing factor 3B associated 14 kDa protein; splicing factor 3b, subunit 7; PHD finger protein 5A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaaacatcatcctgatttgatcttttgccgcaagcaggctggtgttgccatcggaagactgtgtgaaaaatgtgatggcaagtgtgtgatttgtgactcctatgtgcgtccctgcactctggtgcgcatatgtgatgagtgtaactatggatcttaccaggggcgctgtgtgatctgtggaggacctggggtctctgatgcctattattgtaaggagtgcaccatccaggagaaggacagagatggctgcccaaagattgtcaatctggggagctctaagacagacctcttctatgaacgcaaaaaatacggcttcaagaagaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L35 - pantothenate kinase 2 - MYC associated factor X - ribosomal protein L27 |