PTXBC007723
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007723 |
Product type: | DNA & cDNA |
Ncbi symbol: | COX6A1 |
Origin species: | Human |
Product name: | COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene |
Size: | 2ug |
Accessions: | BC007723 |
Gene id: | 1337 |
Gene description: | cytochrome c oxidase subunit VIa polypeptide 1 |
Synonyms: | CMTRID; COX6A; COX6AL; cytochrome c oxidase subunit 6A1, mitochondrial; COX VIa-L; cytochrome C oxidase subunit VIa homolog; cytochrome c oxidase polypeptide VIa-liver; cytochrome c oxidase subunit VIA-liver; cytochrome c oxidase subunit VIa polypeptide 1; cytochrome c oxidase subunit 6A1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcggtagttggtgtgtcctcggtttctcggctgctgggtcggtcccgcccacagctggggcggcctatgtcgagtggcgcccatggcgaagagggctcagctcgcatgtggaagactctcaccttcttcgtcgcgctccccggggtggcagtcagcatgctgaatgtgtacctgaagtcgcaccacggagagcacgagagacccgagttcatcgcctacccccatctccgcatcaggaccaagccgtttccctggggagatggtaaccatactctattccataaccctcatgtgaatccacttccaactggctacgaagatgaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - CDKN2A interacting protein N-terminal like - family with sequence similarity 104, member B - family with sequence similarity 107, member B - family with sequence similarity 185, member A |