Cart 1 Product Products 121,50 € (empty)
-
1 x PHB-prohib...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
Data sheet of IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015423 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFI27L1 |
| Origin species: | Human |
| Product name: | IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC015423 |
| Gene id: | 122509 |
| Gene description: | interferon, alpha-inducible protein 27-like 1 |
| Synonyms: | FAM14B; ISG12C; interferon alpha-inducible protein 27-like protein 1; ISG12(c) protein; family with sequence similarity 14, member B; interferon-stimulated gene 12c protein; interferon alpha inducible protein 27 like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaaggagagtggatgggactcaggcagggctgctgtagcagctgtggtcggaggagttgtggctgtggggactgtgctcgtggcgctcagtgccatgggcttcacctcagtaggaatcgccgcatcctccatagcagccaagatgatgtctacagcagccattgccaacgggggcggagttgctgctggcagtctggtggctattctgcagtcagtgggggcagctggactctctgtgacatctaaagttatcgggggctttgctgggacagctcttggggcctggctgggttcacccccttccagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome c oxidase subunit VIa polypeptide 1 - CDKN2A interacting protein N-terminal like - family with sequence similarity 104, member B - family with sequence similarity 107, member B |