Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene
PTXBC009792
New product
Data sheet of CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009792 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CSTF3 |
| Origin species: | Human |
| Product name: | CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene |
| Size: | 2ug |
| Accessions: | BC009792 |
| Gene id: | 1479 |
| Gene description: | cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
| Synonyms: | CSTF-77; cleavage stimulation factor subunit 3; CF-1 77 kDa subunit; CSTF 77 kDa subunit; cleavage stimulation factor 77 kDa subunit; cleavage stimulation factor, 3' pre-RNA, subunit 3; cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD; cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcaggagacggagccacggagcaggcagctgagtatgtcccagagaaggtgaagaaagcggaaaagaaattagaagagaatccatatgaccttgatgcttggagcattctcattcgagaggcacagaatcaacctatagacaaagcacggaagacttatgaacgccttgttgcccagttccccagttctggcagattctggaaactgtacattgaagcagaggttactattttattttattttttcttatatcagtattgcagcattcactgtagtgatagaaaacaagttaggaacatagccaattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase A2, group IIA (platelets, synovial fluid) - tumor necrosis factor, alpha-induced protein 8-like 1 - cysteine and glycine-rich protein 3 (cardiac LIM protein) - chorionic somatomammotropin hormone 1 (placental lactogen) |