PTXBC006370
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC006370 |
Product type: | DNA & cDNA |
Ncbi symbol: | INVS |
Origin species: | Human |
Product name: | INVS-inversin Gene |
Size: | 2ug |
Accessions: | BC006370 |
Gene id: | 27130 |
Gene description: | inversin |
Synonyms: | INV; NPH2; NPHP2; inversin; inversion of embryo turning homolog; inversion of embryonic turning; nephrocystin-2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaacaagtcagagaacctgctgtttgctggttcatcattagcatcacaagtccatgctgctgccgttaatggagataagggtgctctacagaggctcatcgtaggaaactctgctcttaaagacaaagaagatcagtttgggagaacaccacttatgtattgcgtgttggctgacagattggattgtgcagatgctcttctgaaggcaggagcagatgtgaataaaactgaccatagccagagaacagccctccatcttgcagcccagaaggcattgagaacaatcagcacaggcaggatctaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - melan-A - stratifin - stomatin - cyclin H |