No products
Prices are tax excluded
PTXBC007870
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007870 |
Product type: | DNA & cDNA |
Ncbi symbol: | ENY2 |
Origin species: | Human |
Product name: | ENY2-enhancer of yellow 2 homolog (Drosophila) Gene |
Size: | 2ug |
Accessions: | BC007870 |
Gene id: | 56943 |
Gene description: | enhancer of yellow 2 homolog (Drosophila) |
Synonyms: | ENY2, transcription and export complex 2 subunit; transcription and mRNA export factor ENY2; DC6; Sus1; enhancer of yellow 2 homolog; enhancer of yellow 2 transcription factor homolog |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtggttagcaagatgaacaaagatgcgcagatgagagcagcgattaaccaaaagttgatagaaactggagaaagagaacgcctcaaagagttgctgagagctaaattaattgaatgtggctggaaggatcagttgaaggcacactgtaaagaggtaattaaagaaaaaggactagaacacgttactgttgatgacttggtggctgaaatcactccaaaaggcagagccctggtacctgacagtgtaaagaaggagctcctacaaagaataagaacattccttgctcagcatgccagcctttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - phosphoprotein enriched in astrocytes 15 - polymerase (RNA) I polypeptide D, 16kDa - C-type lectin domain family 2, member B - chromosome 10 open reading frame 111 |