Cart 5 Product Products 609,56 € (empty)
-
1 x HFM1-HFM1,...121,50 € -
1 x DAZ3-delet...121,50 € -
-
1 x SERINC3-se...121,50 € -
1 x SERPINB1-s...121,50 €
No products
To be determined Shipping
609,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 609,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 609,56 €
View larger 
Data sheet of ENY2-enhancer of yellow 2 homolog (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ENY2-enhancer of yellow 2 homolog (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007870 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ENY2 |
| Origin species: | Human |
| Product name: | ENY2-enhancer of yellow 2 homolog (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC007870 |
| Gene id: | 56943 |
| Gene description: | enhancer of yellow 2 homolog (Drosophila) |
| Synonyms: | ENY2, transcription and export complex 2 subunit; transcription and mRNA export factor ENY2; DC6; Sus1; enhancer of yellow 2 homolog; enhancer of yellow 2 transcription factor homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggttagcaagatgaacaaagatgcgcagatgagagcagcgattaaccaaaagttgatagaaactggagaaagagaacgcctcaaagagttgctgagagctaaattaattgaatgtggctggaaggatcagttgaaggcacactgtaaagaggtaattaaagaaaaaggactagaacacgttactgttgatgacttggtggctgaaatcactccaaaaggcagagccctggtacctgacagtgtaaagaaggagctcctacaaagaataagaacattccttgctcagcatgccagcctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoprotein enriched in astrocytes 15 - polymerase (RNA) I polypeptide D, 16kDa - C-type lectin domain family 2, member B - chromosome 10 open reading frame 111 |