Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 219,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 219,00 €
View larger 
VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene
PTXBC005941
New product
Data sheet of VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005941 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAMP3 |
| Origin species: | Human |
| Product name: | VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene |
| Size: | 2ug |
| Accessions: | BC005941 |
| Gene id: | 9341 |
| Gene description: | vesicle-associated membrane protein 3 (cellubrevin) |
| Synonyms: | CEB; vesicle-associated membrane protein 3; VAMP-3; cellubrevin; synaptobrevin-3; vesicle associated membrane protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctacaggtccaactgctgccactggcagtaatcgaagacttcagcagacacaaaatcaagtagatgaggtggtggacataatgcgagttaacgtggacaaggttctggaaagagaccagaagctctctgagttagacgaccgtgcagacgcactgcaggcaggcgcttctcaatttgaaacgagcgcagccaagttgaagaggaaatattggtggaagaattgcgagatgtgggcaatcgggattactgttctggttatcttcatcatcatcatcatcgtgtgggttgtctcttcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - integrin beta 3 binding protein (beta3-endonexin) - v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog - cell division cycle 42 (GTP binding protein, 25kDa) - loss of heterozygosity, 12, chromosomal region 1 |