Cart 22 Product Products 3 066,56 € (empty)
-
1 x C9orf127-c...121,50 € -
1 x NMNAT3-nic...113,40 € -
-
-
1 x COPS5-COP9...121,50 € -
1 x C1orf174-c...113,40 € -
1 x MOBKL3-MOB...113,40 € -
1 x C6orf66-ch...113,40 € -
1 x XRCC6BP1-X...113,40 € -
-
1 x NKp30...259,07 € -
1 x FAM20B-fam...121,50 € -
1 x MPG-N-meth...121,50 € -
1 x GPR137B-G...121,50 € -
1 x DHA Kinase...259,07 € -
1 x COMMD1-cop...113,40 € -
1 x CLDN8-clau...113,40 € -
1 x HLF-hepati...121,50 € -
-
1 x ZNF323-zin...113,40 € -
1 x KRT8-kerat...121,50 € -
1 x NFYA-nucle...121,50 €
No products
To be determined Shipping
3 066,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 066,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 066,56 €
Data sheet of TMEM14A-transmembrane protein 14A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM14A-transmembrane protein 14A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015097 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM14A |
| Origin species: | Human |
| Product name: | TMEM14A-transmembrane protein 14A Gene |
| Size: | 2ug |
| Accessions: | BC015097 |
| Gene id: | 28978 |
| Gene description: | transmembrane protein 14A |
| Synonyms: | C6orf73; PTD011; transmembrane protein 14A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacctgatcggttttggttatgcagccctcgtgacatttggaagcatttttggatataagcggagaggtggtgttccgtctttgattgctggtctttttgttggatgtttggccggctatggagcttaccgtgtctccaatgacaaacgagatgtaaaagtgtcactgtttacagctttcttcctggctaccataatgggtgtgagatttaagaggtccaagaaaataatgcctgctggtttggttgcaggtttaagcctcatgatgatcctgagacttgtcttgttgctgctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 141 - transmembrane protein 14B - transmembrane protein 14B - histone cluster 1, H2bn |