Cart 22 Product Products 4 121,28 € (empty)
-
-
-
-
-
-
1 x HEYL-hairy...121,50 € -
1 x ABHD2-abhy...121,50 € -
-
-
-
1 x HSP27...259,07 € -
1 x AMPKα2...259,07 € -
-
-
-
-
-
-
1 x TGF-beta2494,00 € -
1 x Histone H3...259,07 € -
-
1 x VEGF-C494,00 €
No products
To be determined Shipping
4 121,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 121,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 121,28 €
Data sheet of hCG_1731871-hCG1731871 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about hCG_1731871-hCG1731871 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025725 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | hCG_1731871 |
| Origin species: | Human |
| Product name: | hCG_1731871-hCG1731871 Gene |
| Size: | 2ug |
| Accessions: | BC025725 |
| Gene id: | 653687 |
| Gene description: | hCG1731871 |
| Synonyms: | CXorf50B; LINC00246B; NCRNA00246B; family with sequence similarity 226, member B (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaagtatgtcatcaaaaggtacaggagcttcctccctgagattttcaagaaagcctctgacctccccgagttagtctttgggttctatctgaaggaacttgatccagcagagcactcctatgtcttgatcagaaaaatcgatcctgccctggtttggggcctgacaggcgaccagggcacaccaaagacccggctcctgatgattactctggactcgatcttcatgcaggccagctgtgtccccgaggaggtggtctgggaggtgttgagggtgttggaggcacatttcgtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calpain 3, (p94) - sorting nexin 12 - lysozyme G-like 1 - MARCKS-like 1 |