Cart 35 Product Products 7 379,62 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
-
1 x UGCG-UDP-g...121,50 € -
1 x GEMIN7-gem...113,40 € -
1 x TMEM53-tra...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
1 x C14orf100-...121,50 € -
1 x CCDC115-co...113,40 € -
1 x IL17F-inte...113,40 € -
-
-
1 x SERINC1-se...121,50 € -
1 x LDHA-lacta...121,50 € -
1 x ZNF69-zinc...113,40 € -
1 x ROPN1B-rop...113,40 € -
1 x GHRL-ghrel...113,40 € -
1 x SERPINA3-s...121,50 € -
1 x IFT81-intr...121,50 € -
-
-
1 x SERPINB8-s...113,40 € -
1 x GEMIN8-gem...113,40 € -
-
1 x SERPINB9-s...121,50 € -
-
1 x SERBP1-SER...121,50 €
No products
To be determined Shipping
7 379,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 379,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 379,62 €
View larger 
LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
PTXBC009192
New product
Data sheet of LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009192 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM2 |
| Origin species: | Human |
| Product name: | LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC009192 |
| Gene id: | 57819 |
| Gene description: | LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
| Synonyms: | LSM2 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM2 homolog, U6 small nuclear RNA associated; LSM2 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm2; C6orf28; G7B; YBL026W; snRNP; protein G7b; small nuclear ribonuclear protein D homolog; snRNP core Sm-like protein Sm-x5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcttctattcttttttcaagtcccttgtgggcaaggatgtggtcgtggaactaaagaatgacctgagcatctgtggaaccctccattctgtggatcagtatctcaacatcaaactaactgacatcagtgtcacagaccctgagaaataccctcacatgttatcagtgaagaactgcttcattcggggctcagtggtccgatacgtgcagctgccagcagatgaggtcgacacacagttgctacaggatgcggcaaggaaggaagccctgcagcagaaacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa - myosin, light chain 6B, alkali, smooth muscle and non-muscle - phosphatidic acid phosphatase type 2 domain containing 1B - eukaryotic translation initiation factor 4E family member 2 |