Cart 11 Product Products 2 001,74 € (empty)
-
1 x FLJ20628-h...121,50 € -
1 x Centriolin...259,07 € -
1 x ARHGAP15-R...121,50 € -
1 x PCLO-picco...113,40 € -
1 x KIAA0040-K...113,40 € -
1 x ARHGEF18-r...113,40 € -
1 x BTLA-B and...113,40 € -
1 x RIN1...259,07 € -
1 x NR5A2-nucl...121,50 € -
1 x CTSZ-cathe...121,50 € -
1 x Decorin544,00 €
No products
To be determined Shipping
2 001,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 001,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 001,74 €
Data sheet of MGC13057-hypothetical protein MGC13057 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC13057-hypothetical protein MGC13057 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005083 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC13057 |
| Origin species: | Human |
| Product name: | MGC13057-hypothetical protein MGC13057 Gene |
| Size: | 2ug |
| Accessions: | BC005083 |
| Gene id: | 84281 |
| Gene description: | hypothetical protein MGC13057 |
| Synonyms: | smAKAP; small membrane A-kinase anchor protein; small A-kinase anchoring protein; small membrane AKAP; chromosome 2 open reading frame 88 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctgcatgaaatcaaagcaaactttcccatttcctaccatatatgaaggtgagaagcagcatgagagtgaagaaccctttatgccagaagagagatgtctacctaggatggcttctccagttaatgtcaaagaggaagtgaaggaacctccagggaccaatattgtgatcttggaatatgcacaccgcctgtctcaggatatcttgtgtgatgccttgcagcaatgggcatgcaataacatcaagtaccatgacattccatacattgagagtgaggggccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - S100 calcium binding protein A7 - chemokine (C-X-C motif) ligand 2 - SIVA1, apoptosis-inducing factor - chemokine (C-X-C motif) ligand 5 |