PTXBC016775
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC016775 |
Product type: | DNA & cDNA |
Ncbi symbol: | SUMO2 |
Origin species: | Human |
Product name: | SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene |
Size: | 2ug |
Accessions: | BC016775 |
Gene id: | 6613 |
Gene description: | SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) |
Synonyms: | HSMT3; SMT3B; SMT3H2; SUMO3; Smt3A; small ubiquitin-related modifier 2; SMT3 homolog 2; SMT3 suppressor of mif two 3 homolog 2; sentrin 2; ubiquitin-like protein SMT3A; ubiquitin-like protein SMT3B; small ubiquitin-like modifier 2 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacgatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcagattccgatttgacgggcaaccaatcaatgaaacagacacacctgcacagttggaaatggaggatgaagatacaattgatgtgttccaacagcagacgggaggtgtctactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) - cytochrome c oxidase subunit VIIa polypeptide 2 like - cytochrome c oxidase subunit VIIa polypeptide 2 like - eukaryotic translation initiation factor 1A, X-linked |