PTXBC006438
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC006438 |
Product type: | DNA & cDNA |
Ncbi symbol: | LOC100132167 |
Origin species: | Human |
Product name: | LOC100132167-similar to hCG1993567 Gene |
Size: | 2ug |
Accessions: | BC006438 |
Gene id: | 100132167 |
Gene description: | similar to hCG1993567 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggtgttactatgatcactattttacagctacccaaggtgcgaaaaagaaaaaaggccaaagggaagaaggtggtgctaacccttgcggtcttgaaaaagcaggagaccatgaaagtggtgaatcttccatttgagaaatttggcactggacaggacattttggcattggacagaacatccagcccaaaagggacctcacttgctttgtcaaatggccccattatactaggttgcagcagcagagagccatcctctataagcagctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - dpy-19-like 3 (C. elegans) - N-myc downstream regulated 1 - H2A histone family, member J - ORM1-like 1 (S. cerevisiae) |