Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007516 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELOF1 |
| Origin species: | Human |
| Product name: | ELOF1-elongation factor 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC007516 |
| Gene id: | 84337 |
| Gene description: | elongation factor 1 homolog (S. cerevisiae) |
| Synonyms: | ELF1; transcription elongation factor 1 homolog; ELF1 homolog, elongation factor 1; elongation factor 1 homolog (ELF1, S. cerevisiae); elongation factor 1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcgcagaaagtcaaaacgaaagccgcctcccaagaagaagatgacaggcaccctcgagacccagttcacctgccccttctgcaaccacgagaaatcctgtgatgtgaaaatggaccgtgcccgcaacaccggagtcatctcttgtaccgtgtgcctagaggaattccagacgcccataacgtatctgtcagaacccgtggatgtgtacagtgattggatagacgcctgcgaggcggccaatcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acyl-Coenzyme A binding domain containing 7 - TRAF family member-associated NFKB activator - Morf4 family associated protein 1-like 1 - CD59 molecule, complement regulatory protein |