Cart 1 Product Products 113,40 € (empty)
-
1 x APOBEC3C-a...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of MOBP-myelin-associated oligodendrocyte basic protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MOBP-myelin-associated oligodendrocyte basic protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022471 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MOBP |
| Origin species: | Human |
| Product name: | MOBP-myelin-associated oligodendrocyte basic protein Gene |
| Size: | 2ug |
| Accessions: | BC022471 |
| Gene id: | 4336 |
| Gene description: | myelin-associated oligodendrocyte basic protein |
| Synonyms: | myelin-associated oligodendrocyte basic protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtcagaaaccggccaaggagggtcccagactctccaaaaaccagaagtactccgaacacttcagcatacactgctgcccgccgttcaccttcctcaattccaagaaggagatagtggatcggaaatacagcatctgtaagagcggctgcttctaccagaagaaagaggaggactggatctgctgcgcctgccagaagaccagattgaaaaggaagatcaggccaaccccaaagaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcript expressed during hematopoiesis 2 - GABA(A) receptor-associated protein-like 2 - GABA(A) receptor-associated protein-like 2 - protein tyrosine phosphatase, receptor type, S |