PTXBC014300
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC014300 |
Product type: | DNA & cDNA |
Ncbi symbol: | CTNNBIP1 |
Origin species: | Human |
Product name: | CTNNBIP1-catenin, beta interacting protein 1 Gene |
Size: | 2ug |
Accessions: | BC014300 |
Gene id: | 56998 |
Gene description: | catenin, beta interacting protein 1 |
Synonyms: | beta-catenin-interacting protein 1; beta-catenin-interacting protein ICAT; inhibitor of beta-catenin and Tcf-4; catenin beta interacting protein 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaaccgcgagggagctcccgggaagagtccggaggagatgtacattcagcagaaggtccgagtgctgctcatgctgcggaagatgggatcaaacctgacagccagcgaggaggagttcctgcgcacctatgcaggggtggtcaacagccagctcagccagctgcctccgcactccatcgaccagggtgcagaggacgtggtgatggcgttttccaggtcggagacggaagaccggaggcagtag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 15 open reading frame 48 - chromosome 16 open reading frame 57 - chromosome 16 open reading frame 52 - chromosome 18 open reading frame 20 |