PTXBC018619
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC018619 |
Product type: | DNA & cDNA |
Ncbi symbol: | FXYD7 |
Origin species: | Human |
Product name: | FXYD7-FXYD domain containing ion transport regulator 7 Gene |
Size: | 2ug |
Accessions: | BC018619 |
Gene id: | 53822 |
Gene description: | FXYD domain containing ion transport regulator 7 |
Synonyms: | FXYD domain-containing ion transport regulator 7; FXYD domain containing ion transport regulator 7 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcgaccccgacccagacccccacaaaggctcctgaggaacctgacccattttactatgactacaacacggtgcagactgtgggcatgactctggcaaccatcttgttcctgctgggtatcctcatcgtcatcagcaagaaggtgaagtgcaggaaggcggactccaggtctgagagcccaacctgcaaatcctgtaagtctgagcttccctcttcagcccctggtggcggcggcgtgtaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - angiogenic factor with G patch and FHA domains 1 - cyclin-dependent kinase 2 associated protein 1 - thyroid hormone responsive (SPOT14 homolog, rat) - P antigen family, member 1 (prostate associated) |