Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM167B-family with sequence similarity 167, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM167B-family with sequence similarity 167, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004269 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM167B |
| Origin species: | Human |
| Product name: | FAM167B-family with sequence similarity 167, member B Gene |
| Size: | 2ug |
| Accessions: | BC004269 |
| Gene id: | 84734 |
| Gene description: | family with sequence similarity 167, member B |
| Synonyms: | protein FAM167B; C1orf90; family with sequence similarity 167 member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggcgcaggacaggcagctggcagggcagctgctgcggctgcgggcccagctgcaccgactgaagatggaccaagcctgtcacctgcaccaggagctgctggatgaggccgagctggagctggagctggagcccggggccggcctagccctggccccgctgctgcggcacctgggcctcacgcgcatgaacatcagcgcccggcgcttcaccctctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcription elongation factor A (SII)-like 7 - interferon, alpha-inducible protein 27-like 1 - cytochrome c oxidase subunit VIa polypeptide 1 - CDKN2A interacting protein N-terminal like |