Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene
PTXBC010384
New product
Data sheet of GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010384 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNG10 |
| Origin species: | Human |
| Product name: | GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene |
| Size: | 2ug |
| Accessions: | BC010384 |
| Gene id: | 2790 |
| Gene description: | guanine nucleotide binding protein (G protein), gamma 10 |
| Synonyms: | guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-10; guanine nucleotide binding protein (G protein), gamma 10; guanine nucleotide binding protein 10; G protein subunit gamma 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctccggggctagcgcgagcgccctgcagcgcttggtagagcagctcaagttggaggctggcgtggagaggatcaaggtctctcaggcagctgcagagcttcaacagtactgtatgcagaatgcctgcaaggatgccctgctggtgggtgttccagctggaagtaaccccttccgggagcctagatcctgtgctttactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil-helix-coiled-coil-helix domain containing 5 - coiled-coil-helix-coiled-coil-helix domain containing 1 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |