> >>MGC12966-hypothetical protein LOC84792 Gene
MGC12966-hypothetical protein LOC84792 Gene View larger

MGC12966-hypothetical protein LOC84792 Gene

New product

519,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MGC12966-hypothetical protein LOC84792 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC12966-hypothetical protein LOC84792 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006110
Product type: DNA & cDNA
Ncbi symbol: MGC12966
Origin species: Human
Product name: MGC12966-hypothetical protein LOC84792 Gene
Size: 2ug
Accessions: BC006110
Gene id: 84792
Gene description: hypothetical protein LOC84792
Synonyms: ACPIN1; C7orf70; SIPAR; protein FAM220A; STAT3-interacting protein as a repressor; family with sequence similarity 220 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggctctgtcgggcctggctgtccggctctcgcgctcggccgccgcccgctcctatggggtcttctgcaaggggctgactcgcacgctgctcatcttcttcgacctggcctggcggctgcgtatcaacttcccctacctctacatcgtggcttccatgatgctcaacgtccgcctgcaggttcatattgagatccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein FLJ22795
- S100 calcium binding protein A8
- hypothetical protein MGC13057
- S100 calcium binding protein A7

Reviews

Buy MGC12966-hypothetical protein LOC84792 Gene now

Add to cart