PTXBC016805
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC016805 |
Product type: | DNA & cDNA |
Ncbi symbol: | C14orf147 |
Origin species: | Human |
Product name: | C14orf147-chromosome 14 open reading frame 147 Gene |
Size: | 2ug |
Accessions: | BC016805 |
Gene id: | 171546 |
Gene description: | chromosome 14 open reading frame 147 |
Synonyms: | C14orf147; SSSPTA; serine palmitoyltransferase small subunit A; small subunit of serine palmitoyltransferase A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcgctggcgcgggcctggaagcagatgtcctggttctactaccagtacctgctggtcacggcgctctacatgctggagccctgggagcggacggtgttcaattccatgctggtttccattgtggggatggcactatacacaggatacgtcttcatgccccagcacatcatggcgatattgcactactttgaaatcgtacaatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - enhancer of yellow 2 homolog (Drosophila) - phosphoprotein enriched in astrocytes 15 - polymerase (RNA) I polypeptide D, 16kDa - C-type lectin domain family 2, member B |