C14orf147-chromosome 14 open reading frame 147 Gene View larger

C14orf147-chromosome 14 open reading frame 147 Gene

PTXBC016805

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf147-chromosome 14 open reading frame 147 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf147-chromosome 14 open reading frame 147 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016805
Product type: DNA & cDNA
Ncbi symbol: C14orf147
Origin species: Human
Product name: C14orf147-chromosome 14 open reading frame 147 Gene
Size: 2ug
Accessions: BC016805
Gene id: 171546
Gene description: chromosome 14 open reading frame 147
Synonyms: C14orf147; SSSPTA; serine palmitoyltransferase small subunit A; small subunit of serine palmitoyltransferase A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctggcgcgggcctggaagcagatgtcctggttctactaccagtacctgctggtcacggcgctctacatgctggagccctgggagcggacggtgttcaattccatgctggtttccattgtggggatggcactatacacaggatacgtcttcatgccccagcacatcatggcgatattgcactactttgaaatcgtacaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - enhancer of yellow 2 homolog (Drosophila)
- phosphoprotein enriched in astrocytes 15
- polymerase (RNA) I polypeptide D, 16kDa
- C-type lectin domain family 2, member B

Reviews

Buy C14orf147-chromosome 14 open reading frame 147 Gene now

Add to cart