POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene View larger

POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene

PTXBC018649

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018649
Product type: DNA & cDNA
Ncbi symbol: POLR2L
Origin species: Human
Product name: POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene
Size: 2ug
Accessions: BC018649
Gene id: 5441
Gene description: polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Synonyms: RBP10; RPABC5; RPB10; RPB10beta; RPB7.6; hRPB7.6; DNA-directed RNA polymerases I, II, and III subunit RPABC5; DNA-directed RNA polymerase III subunit L; RNA polymerase II 7.6 kDa subunit; RNA polymerases I, II, and III subunit ABC5; RPB10 homolog; polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa; polymerase (RNA) II subunit L; RNA polymerase II subunit L
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcatccctgtacgctgcttcacttgtggcaagatcgtcggcaacaagtgggaggcttacctggggctgctgcaggccgagtacaccgagggggacgcgctggatgccctgggcctgaagcgctactgctgccgccggatgctgctggcccacgtggacctgatcgagaagctgctcaattatgcacccctggagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
- phospholipase A2, group IIA (platelets, synovial fluid)
- tumor necrosis factor, alpha-induced protein 8-like 1
- cysteine and glycine-rich protein 3 (cardiac LIM protein)

Reviews

Buy POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene now

Add to cart